anti st6gal i goat polyclonal antibody (R&D Systems)
R&D Systems is a verified supplier 
R&D Systems manufactures this product 
95
Structured Review
R&D Systems
anti st6gal i goat polyclonal antibody
Anti St6gal I Goat Polyclonal Antibody, supplied by R&D Systems, used in various techniques. Bioz Stars score: 95/100, based on 61 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/anti+st6gal+i+goat+polyclonal+antibody/Human+ST6+Gal+Sialyltransferase+1%2F+ST6GAL1+Antibody/10__1074_slash_jbc__ra120__014126-195-9-13
Average 95 stars, based on 61 article reviews
Anti St6gal I Goat Polyclonal Antibody, supplied by R&D Systems, used in various techniques. Bioz Stars score: 95/100, based on 61 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/anti+st6gal+i+goat+polyclonal+antibody/Human+ST6+Gal+Sialyltransferase+1%2F+ST6GAL1+Antibody/10__1074_slash_jbc__ra120__014126-195-9-13
Average 95 stars, based on 61 article reviews
anti st6gal i goat polyclonal antibody - by Bioz Stars,
2026-10
95/100 stars
Images
Related Articles
Over Expression:Article Title: Glycosyltransferase ST6Gal-I promotes the epithelial to mesenchymal transition in pancreatic cancer cells Article Snippet: .. Successful overexpression or knockdown was confirmed by immunoblotting using Article Title: The Glycosyltransferase ST6Gal-I Protects Tumor Cells against Serum Growth Factor Withdrawal by Enhancing Survival Signaling and Proliferative Potential Article Snippet: Stable polyclonal cell lines were created by transducing cells with a lentivirus encoding either the ST6Gal-I gene (Genecopoeia) or shRNA against ST6Gal-I (Sigma, TRCN00000035432, sequence CCGGCGTGTGCTACTACTACCAGAACTCGAGTTCTGGTAGTAGTAGCACACGTTTTTG), followed by selection with puromycin. .. ST6Gal-I overexpression or knockdown was verified by immunoblotting whole cell lysates with Article Title: Sialylation of EGFR by the ST6Gal-I sialyltransferase promotes EGFR activation and resistance to gefitinib-mediated cell death Article Snippet: .. Overexpression or knockdown of ST6Gal-I was verified via immunoblot using Article Title: Glycosyltransferase ST6Gal-I promotes the epithelial to mesenchymal transition in pancreatic cancer cells Article Snippet: .. Successful overexpression or knockdown was confirmed by immunoblotting using Article Title: Sialylation of EGFR by the ST6Gal-I sialyltransferase promotes EGFR activation and resistance to gefitinib-mediated cell death. Article Snippet: .. Overexpression or knockdown of ST6Gal-I was verified via immunoblot using Knockdown:Article Title: Glycosyltransferase ST6Gal-I promotes the epithelial to mesenchymal transition in pancreatic cancer cells Article Snippet: .. Successful overexpression or knockdown was confirmed by immunoblotting using Article Title: The Glycosyltransferase ST6Gal-I Protects Tumor Cells against Serum Growth Factor Withdrawal by Enhancing Survival Signaling and Proliferative Potential Article Snippet: Stable polyclonal cell lines were created by transducing cells with a lentivirus encoding either the ST6Gal-I gene (Genecopoeia) or shRNA against ST6Gal-I (Sigma, TRCN00000035432, sequence CCGGCGTGTGCTACTACTACCAGAACTCGAGTTCTGGTAGTAGTAGCACACGTTTTTG), followed by selection with puromycin. .. ST6Gal-I overexpression or knockdown was verified by immunoblotting whole cell lysates with Article Title: Sialylation of EGFR by the ST6Gal-I sialyltransferase promotes EGFR activation and resistance to gefitinib-mediated cell death Article Snippet: .. Overexpression or knockdown of ST6Gal-I was verified via immunoblot using Article Title: Glycosyltransferase ST6Gal-I promotes the epithelial to mesenchymal transition in pancreatic cancer cells Article Snippet: .. Successful overexpression or knockdown was confirmed by immunoblotting using Article Title: Sialylation of EGFR by the ST6Gal-I sialyltransferase promotes EGFR activation and resistance to gefitinib-mediated cell death. Article Snippet: .. Overexpression or knockdown of ST6Gal-I was verified via immunoblot using Western Blot:Article Title: Glycosyltransferase ST6Gal-I promotes the epithelial to mesenchymal transition in pancreatic cancer cells Article Snippet: .. Successful overexpression or knockdown was confirmed by immunoblotting using Article Title: The Glycosyltransferase ST6Gal-I Protects Tumor Cells against Serum Growth Factor Withdrawal by Enhancing Survival Signaling and Proliferative Potential Article Snippet: Stable polyclonal cell lines were created by transducing cells with a lentivirus encoding either the ST6Gal-I gene (Genecopoeia) or shRNA against ST6Gal-I (Sigma, TRCN00000035432, sequence CCGGCGTGTGCTACTACTACCAGAACTCGAGTTCTGGTAGTAGTAGCACACGTTTTTG), followed by selection with puromycin. .. ST6Gal-I overexpression or knockdown was verified by immunoblotting whole cell lysates with Article Title: Sialylation of EGFR by the ST6Gal-I sialyltransferase promotes EGFR activation and resistance to gefitinib-mediated cell death Article Snippet: .. Overexpression or knockdown of ST6Gal-I was verified via immunoblot using Article Title: Glycosyltransferase ST6Gal-I promotes the epithelial to mesenchymal transition in pancreatic cancer cells Article Snippet: .. Successful overexpression or knockdown was confirmed by immunoblotting using Article Title: Sialylation of EGFR by the ST6Gal-I sialyltransferase promotes EGFR activation and resistance to gefitinib-mediated cell death. Article Snippet: .. Overexpression or knockdown of ST6Gal-I was verified via immunoblot using Real-time Polymerase Chain Reaction:Article Title: The Glycosyltransferase ST6Gal-I Protects Tumor Cells against Serum Growth Factor Withdrawal by Enhancing Survival Signaling and Proliferative Potential Article Snippet: Stable polyclonal cell lines were created by transducing cells with a lentivirus encoding either the ST6Gal-I gene (Genecopoeia) or shRNA against ST6Gal-I (Sigma, TRCN00000035432, sequence CCGGCGTGTGCTACTACTACCAGAACTCGAGTTCTGGTAGTAGTAGCACACGTTTTTG), followed by selection with puromycin. .. ST6Gal-I overexpression or knockdown was verified by immunoblotting whole cell lysates with |